Sequence retrieval

Genome: Rhodococcus pyridinivorans SB3094
Start position: 1390662
End position: 1390715
Length: 54

DNA sequence
>NC_023150, from 1390662 to 1390715 (54 bp); Rhodococcus pyridinivorans SB3094 GTGGCGGTGGTCTTCTTCGCCGCCGTGGTCTTCTTCGCTGCGGTGGTCTTCTTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1390410-1391126	Sequence	Y013_06655 - DNA-binding protein (Protein is coded in complementary strand; from 1391126 to 1390410)