Sequence retrieval

Genome: Rhodococcus pyridinivorans SB3094
Start position: 1213315
End position: 1213338
Length: 24

DNA sequence
>NC_023150, from 1213315 to 1213338 (24 bp); Rhodococcus pyridinivorans SB3094 CGGCGGCGACGGCGGCCGCGGCGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1211967-1213508	Sequence	Y013_05775 - UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase (Protein is coded in complementary strand; from 1213508 to 1211967)