Sequence retrieval

Genome: Rhodococcus pyridinivorans SB3094
Start position: 1203069
End position: 1203092
Length: 24

DNA sequence
>NC_023150, from 1203069 to 1203092 (24 bp); Rhodococcus pyridinivorans SB3094 CGGCTGCTGCTGCTGCTGCGGCTG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1202866-1204098	Sequence	Y013_05740 - cell division protein FtsZ (Protein is coded in complementary strand; from 1204098 to 1202866)