Sequence retrieval

Genome: Rhodococcus pyridinivorans SB3094
Start position: 1191955
End position: 1191978
Length: 24

DNA sequence
>NC_023150, from 1191955 to 1191978 (24 bp); Rhodococcus pyridinivorans SB3094 CCGAGGACGAGGGCGAGGCCGAGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1191712-1192326	Sequence	Y013_05685 - peptidase A8 (Protein is coded in complementary strand; from 1192326 to 1191712)