Sequence retrieval

Genome: Rhodococcus pyridinivorans SB3094
Start position: 118483
End position: 118538
Length: 56

DNA sequence
>NC_023150, from 118483 to 118538 (56 bp); Rhodococcus pyridinivorans SB3094 AGCTGACCCGACTCAGCTGACCCGACTCAGCAGATCCGACTCAGCAGATCCGACTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF.. 117692-118489	Sequence	Y013_00545 - DNA glycosylase
ORF... 118538-119332	Sequence	Y013_00550 - hypothetical protein (Protein is coded in complementary strand; from 119332 to 118538)