Sequence retrieval

Genome: Rhodococcus pyridinivorans SB3094
Start position: 1121179
End position: 1121202
Length: 24

DNA sequence
>NC_023150, from 1121179 to 1121202 (24 bp); Rhodococcus pyridinivorans SB3094 GCGGCGGCGACGGCGACGGCCGCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1120825-1121490	Sequence	Y013_05335 - membrane protein (Protein is coded in complementary strand; from 1121490 to 1120825)