Sequence retrieval

Genome: Rhodococcus pyridinivorans SB3094
Start position: 1116637
End position: 1116681
Length: 45

DNA sequence
>NC_023150, from 1116637 to 1116681 (45 bp); Rhodococcus pyridinivorans SB3094 GGCAGGCTCCGTCTTGTCGGGCTCCGGCTTGGCAGGCTCCGAATC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1115768-1116718	Sequence	Y013_05310 - hypothetical protein (Protein is coded in complementary strand; from 1116718 to 1115768)