Sequence retrieval

Genome: Rhodococcus pyridinivorans SB3094
Start position: 1067631
End position: 1067678
Length: 48

DNA sequence
>NC_023150, from 1067631 to 1067678 (48 bp); Rhodococcus pyridinivorans SB3094 CGGTGTCCCCGCGACTCGGTGTCCCCGCGACTCGGTGTCCCCGCGACT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF... 1067679-1070402	Sequence	Y013_05085 - DNA polymerase I (Protein is coded in complementary strand; from 1070402 to 1067679)