Sequence retrieval

Genome: Leisingera methylohalidivorans DSM 14336 strain MB2, DSM 14336
Start position: 969954
End position: 969977
Length: 24

DNA sequence
>NC_023135, from 969954 to 969977 (24 bp); Leisingera methylohalidivorans DSM 14336 strain MB2, DSM 14336 CTGCCGCGCGGCCGCGCTGCCGCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 969838-970896	Sequence	METH_04985 - type I secretion protein (Protein is coded in complementary strand; from 970896 to 969838)