Sequence retrieval

Genome: Leisingera methylohalidivorans DSM 14336 strain MB2, DSM 14336
Start position: 948996
End position: 949019
Length: 24

DNA sequence
>NC_023135, from 948996 to 949019 (24 bp); Leisingera methylohalidivorans DSM 14336 strain MB2, DSM 14336 CCAGCTCCAGTTCCAGCGCCAGCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 948683-949729	Sequence	METH_04880 - conjugative transfer protein GumN (Protein is coded in complementary strand; from 949729 to 948683)