Sequence retrieval

Genome: Leisingera methylohalidivorans DSM 14336 strain MB2, DSM 14336
Start position: 835437
End position: 835466
Length: 30

DNA sequence
>NC_023135, from 835437 to 835466 (30 bp); Leisingera methylohalidivorans DSM 14336 strain MB2, DSM 14336 GCAGGGCGGAGCGGGCCGGAGCGGGGCAGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 835372-836139	Sequence	METH_04360 - hypothetical protein (Protein is coded in complementary strand; from 836139 to 835372)