Sequence retrieval

Genome: Leisingera methylohalidivorans DSM 14336 strain MB2, DSM 14336
Start position: 765068
End position: 765091
Length: 24

DNA sequence
>NC_023135, from 765068 to 765091 (24 bp); Leisingera methylohalidivorans DSM 14336 strain MB2, DSM 14336 CGGCGACGGCGCAGGCGACGGCCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 763408-765807	Sequence	METH_04015 - aldehyde oxidase (Protein is coded in complementary strand; from 765807 to 763408)