Sequence retrieval

Genome: Leisingera methylohalidivorans DSM 14336 strain MB2, DSM 14336
Start position: 634911
End position: 634937
Length: 27

DNA sequence
>NC_023135, from 634911 to 634937 (27 bp); Leisingera methylohalidivorans DSM 14336 strain MB2, DSM 14336 GCTGCGGCTGCTGCGGCTGCTGTGGCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 634010-635440	Sequence	METH_03405 - glycerol-3-phosphate O-acyltransferase