Sequence retrieval

Genome: Leisingera methylohalidivorans DSM 14336 strain MB2, DSM 14336
Start position: 54818
End position: 54841
Length: 24

DNA sequence
>NC_023135, from 54818 to 54841 (24 bp); Leisingera methylohalidivorans DSM 14336 strain MB2, DSM 14336 TGGCGCTGGTGCTGCCGCTGGCGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 54503-56182	Sequence	METH_00265 - iron ABC transporter permease