Sequence retrieval

Genome: Leisingera methylohalidivorans DSM 14336 strain MB2, DSM 14336
Start position: 545532
End position: 545555
Length: 24

DNA sequence
>NC_023135, from 545532 to 545555 (24 bp); Leisingera methylohalidivorans DSM 14336 strain MB2, DSM 14336 GCCAGCGCCAGCACCAGCGCCAGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 545385-546347	Sequence	METH_02910 ubiA 4-hydroxybenzoate polyprenyltransferase (Protein is coded in complementary strand; from 546347 to 545385)