Sequence retrieval

Genome: Leisingera methylohalidivorans DSM 14336 strain MB2, DSM 14336
Start position: 3671933
End position: 3671968
Length: 36

DNA sequence
>NC_023135, from 3671933 to 3671968 (36 bp); Leisingera methylohalidivorans DSM 14336 strain MB2, DSM 14336 TGCCCGTCCCTGTGTCCGTCGCTGTGCCCGTCTCTG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3671057-3671983	Sequence	METH_18730 - CAAX amino terminal protease (Protein is coded in complementary strand; from 3671983 to 3671057)