Sequence retrieval

Genome: Leisingera methylohalidivorans DSM 14336 strain MB2, DSM 14336
Start position: 3538595
End position: 3538639
Length: 45

DNA sequence
>NC_023135, from 3538595 to 3538639 (45 bp); Leisingera methylohalidivorans DSM 14336 strain MB2, DSM 14336 CTTTCGCTCCGCTTACTTTGGCTCCGCTGACCTTGGCTCCGCTGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3538576-3539400	Sequence	METH_18120 - hypothetical protein (Protein is coded in complementary strand; from 3539400 to 3538576)