Sequence retrieval

Genome: Leisingera methylohalidivorans DSM 14336 strain MB2, DSM 14336
Start position: 3475068
End position: 3475091
Length: 24

DNA sequence
>NC_023135, from 3475068 to 3475091 (24 bp); Leisingera methylohalidivorans DSM 14336 strain MB2, DSM 14336 GATGCTGCTGCTGATCCTGATCCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3473807-3475129	Sequence	METH_17800 - C4-dicarboxylate ABC transporter permease