Sequence retrieval

Genome: Leisingera methylohalidivorans DSM 14336 strain MB2, DSM 14336
Start position: 3446314
End position: 3446337
Length: 24

DNA sequence
>NC_023135, from 3446314 to 3446337 (24 bp); Leisingera methylohalidivorans DSM 14336 strain MB2, DSM 14336 CAGCAGCAGCGGCATCAGCACCAG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3444443-3446407	Sequence	METH_17635 - histidine kinase (Protein is coded in complementary strand; from 3446407 to 3444443)