Sequence retrieval

Genome: Leisingera methylohalidivorans DSM 14336 strain MB2, DSM 14336
Start position: 339272
End position: 339295
Length: 24

DNA sequence
>NC_023135, from 339272 to 339295 (24 bp); Leisingera methylohalidivorans DSM 14336 strain MB2, DSM 14336 CAGCCCAAGCCCCAGCGCCAGCAC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 338220-340745	Sequence	METH_01790 - drug:proton antiporter (Protein is coded in complementary strand; from 340745 to 338220)