Sequence retrieval

Genome: Leisingera methylohalidivorans DSM 14336 strain MB2, DSM 14336
Start position: 3384007
End position: 3384033
Length: 27

DNA sequence
>NC_023135, from 3384007 to 3384033 (27 bp); Leisingera methylohalidivorans DSM 14336 strain MB2, DSM 14336 CCAACGGCAGCAACGGCAACAACGGCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3383500-3384288	Sequence	METH_17275 - hypothetical protein