Sequence retrieval

Genome: Leisingera methylohalidivorans DSM 14336 strain MB2, DSM 14336
Start position: 3271608
End position: 3271643
Length: 36

DNA sequence
>NC_023135, from 3271608 to 3271643 (36 bp); Leisingera methylohalidivorans DSM 14336 strain MB2, DSM 14336 GGATGCGGCCTGAGATACGGCCTGGGATGCGCTCTG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3269881-3271683	Sequence	METH_16735 - rhizobactin siderophore biosynthesis protein rhbC (Protein is coded in complementary strand; from 3271683 to 3269881)