Sequence retrieval

Genome: Leisingera methylohalidivorans DSM 14336 strain MB2, DSM 14336
Start position: 2975282
End position: 2975305
Length: 24

DNA sequence
>NC_023135, from 2975282 to 2975305 (24 bp); Leisingera methylohalidivorans DSM 14336 strain MB2, DSM 14336 CCATCGCCAGCGCGATCGCCAGCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2973679-2975619	Sequence	METH_15285 - ATPase AAA (Protein is coded in complementary strand; from 2975619 to 2973679)