Sequence retrieval

Genome: Leisingera methylohalidivorans DSM 14336 strain MB2, DSM 14336
Start position: 2908877
End position: 2908906
Length: 30

DNA sequence
>NC_023135, from 2908877 to 2908906 (30 bp); Leisingera methylohalidivorans DSM 14336 strain MB2, DSM 14336 CCGGCACCGACATCGGCACCGCCACCGGCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2908319-2909206	Sequence	METH_14925 - dibenzothiophene desulfurase