Sequence retrieval

Genome: Leisingera methylohalidivorans DSM 14336 strain MB2, DSM 14336
Start position: 2760600
End position: 2760635
Length: 36

DNA sequence
>NC_023135, from 2760600 to 2760635 (36 bp); Leisingera methylohalidivorans DSM 14336 strain MB2, DSM 14336 ACAAGCTGCGCGAAGAGCTGCGCGACCAGCTGCCCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2760108-2761172	Sequence	METH_14220 - ABC transporter ATP-binding protein