Sequence retrieval

Genome: Leisingera methylohalidivorans DSM 14336 strain MB2, DSM 14336
Start position: 2755103
End position: 2755156
Length: 54

DNA sequence
>NC_023135, from 2755103 to 2755156 (54 bp); Leisingera methylohalidivorans DSM 14336 strain MB2, DSM 14336 ACCAAAGGATCCGGCGGCACCAAAGGATCCGGCGGCACCAAAGGATCCGGCGGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2754855-2756738	Sequence	METH_14205 - hypothetical protein