Sequence retrieval

Genome: Leisingera methylohalidivorans DSM 14336 strain MB2, DSM 14336
Start position: 2674722
End position: 2674745
Length: 24

DNA sequence
>NC_023135, from 2674722 to 2674745 (24 bp); Leisingera methylohalidivorans DSM 14336 strain MB2, DSM 14336 CGGCCTCTGCCTCGGCCGCCGCCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2673683-2674936	Sequence	METH_13865 - tRNA(Ile)-lysidine synthetase (Protein is coded in complementary strand; from 2674936 to 2673683)