Sequence retrieval

Genome: Leisingera methylohalidivorans DSM 14336 strain MB2, DSM 14336
Start position: 2552407
End position: 2552430
Length: 24

DNA sequence
>NC_023135, from 2552407 to 2552430 (24 bp); Leisingera methylohalidivorans DSM 14336 strain MB2, DSM 14336 GCCTGCGCCTGCGCATGCGCCTGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2552176-2552658	Sequence	METH_13270 - calcium-binding protein (Protein is coded in complementary strand; from 2552658 to 2552176)