Sequence retrieval

Genome: Leisingera methylohalidivorans DSM 14336 strain MB2, DSM 14336
Start position: 2457624
End position: 2457650
Length: 27

DNA sequence
>NC_023135, from 2457624 to 2457650 (27 bp); Leisingera methylohalidivorans DSM 14336 strain MB2, DSM 14336 TCATGGGCGTCATGGACGTCATGGGCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF.. 2456912-2457628	Sequence	METH_12770 - dithiobiotin synthetase (Protein is coded in complementary strand; from 2457628 to 2456912)
ORF... 2457643-2458782	Sequence	METH_12775 - 8-amino-7-oxononanoate synthase (Protein is coded in complementary strand; from 2458782 to 2457643)