Sequence retrieval

Genome: Leisingera methylohalidivorans DSM 14336 strain MB2, DSM 14336
Start position: 1809926
End position: 1809949
Length: 24

DNA sequence
>NC_023135, from 1809926 to 1809949 (24 bp); Leisingera methylohalidivorans DSM 14336 strain MB2, DSM 14336 CCCGCCCCTGCCCCTGCCCCTGCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1809358-1810299	Sequence	METH_09375 - molecular chaperone DnaJ (Protein is coded in complementary strand; from 1810299 to 1809358)