Sequence retrieval

Genome: Leisingera methylohalidivorans DSM 14336 strain MB2, DSM 14336
Start position: 1802628
End position: 1802675
Length: 48

DNA sequence
>NC_023135, from 1802628 to 1802675 (48 bp); Leisingera methylohalidivorans DSM 14336 strain MB2, DSM 14336 CTGTCCTGTTTTAAGCCGGGCCGGTTTTAAGCCGGGCCTGTTTTAAGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF... 1802671-1803237	Sequence	METH_09340 - peptidase U35 (Protein is coded in complementary strand; from 1803237 to 1802671)