Sequence retrieval

Genome: Leisingera methylohalidivorans DSM 14336 strain MB2, DSM 14336
Start position: 1773660
End position: 1773689
Length: 30

DNA sequence
>NC_023135, from 1773660 to 1773689 (30 bp); Leisingera methylohalidivorans DSM 14336 strain MB2, DSM 14336 CCGCCGCTGCCGCCGCTGCTGCCGCCGCTG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1772835-1776137	Sequence	METH_09185 - hypothetical protein (Protein is coded in complementary strand; from 1776137 to 1772835)