Sequence retrieval

Genome: Leisingera methylohalidivorans DSM 14336 strain MB2, DSM 14336
Start position: 1438312
End position: 1438338
Length: 27

DNA sequence
>NC_023135, from 1438312 to 1438338 (27 bp); Leisingera methylohalidivorans DSM 14336 strain MB2, DSM 14336 GATCGCGAAGATCCCGAAGATCACGAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1437281-1438483	Sequence	METH_07495 - ABC transporter permease (Protein is coded in complementary strand; from 1438483 to 1437281)