Sequence retrieval

Genome: Leisingera methylohalidivorans DSM 14336 strain MB2, DSM 14336
Start position: 1245891
End position: 1245914
Length: 24

DNA sequence
>NC_023135, from 1245891 to 1245914 (24 bp); Leisingera methylohalidivorans DSM 14336 strain MB2, DSM 14336 GCGGCGGCGACGGCGCCGGCGACG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1245636-1245941	Sequence	METH_06425 - signal peptide protein (Protein is coded in complementary strand; from 1245941 to 1245636)