Sequence retrieval

Genome: Leisingera methylohalidivorans DSM 14336 strain MB2, DSM 14336
Start position: 1136918
End position: 1136941
Length: 24

DNA sequence
>NC_023135, from 1136918 to 1136941 (24 bp); Leisingera methylohalidivorans DSM 14336 strain MB2, DSM 14336 GGCGGCGGCGGGGGAGGCGGCGGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1136906-1138084	Sequence	METH_05840 - antifreeze protein, type I (Protein is coded in complementary strand; from 1138084 to 1136906)