Sequence retrieval

Genome: Leisingera methylohalidivorans DSM 14336 strain MB2, DSM 14336
Start position: 1085143
End position: 1085166
Length: 24

DNA sequence
>NC_023135, from 1085143 to 1085166 (24 bp); Leisingera methylohalidivorans DSM 14336 strain MB2, DSM 14336 GCGGGGGCGGGACCGGGGGCGGGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1084735-1085241	Sequence	METH_05605 - DNA polymerase III subunit alpha (Protein is coded in complementary strand; from 1085241 to 1084735)