Sequence retrieval

Genome: Leisingera methylohalidivorans DSM 14336 strain MB2, DSM 14336
Start position: 1070943
End position: 1071014
Length: 72

DNA sequence
>NC_023135, from 1070943 to 1071014 (72 bp); Leisingera methylohalidivorans DSM 14336 strain MB2, DSM 14336 CTTCGGCTTCGGCTTCGGCTTCGGCTTCGGCTTCGGCTTCGGCTTCGGCTTCGGCTTCGGCTTCGGCTTC GG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1069481-1071580	Sequence	METH_05535 - chemotaxis protein CheA (Protein is coded in complementary strand; from 1071580 to 1069481)