Sequence retrieval

Genome: Leisingera methylohalidivorans DSM 14336 strain MB2, DSM 14336
Start position: 1042935
End position: 1042979
Length: 45

DNA sequence
>NC_023135, from 1042935 to 1042979 (45 bp); Leisingera methylohalidivorans DSM 14336 strain MB2, DSM 14336 TGATCCGGCGGCTGATGTTCCGGCGGCTGATGTTCCGGCAGTTGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1042763-1044007	Sequence	METH_05385 - hypothetical protein