Sequence retrieval

Genome: Leisingera methylohalidivorans DSM 14336 strain MB2, DSM 14336
Start position: 1036000
End position: 1036023
Length: 24

DNA sequence
>NC_023135, from 1036000 to 1036023 (24 bp); Leisingera methylohalidivorans DSM 14336 strain MB2, DSM 14336 GCTTCGGCTTCCGCTGCGGCTTCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1034989-1036788	Sequence	METH_05340 - elongation factor 4