Sequence retrieval

Genome: Ehrlichia muris AS145
Start position: 841617
End position: 841640
Length: 24

DNA sequence
>NC_023063, from 841617 to 841640 (24 bp); Ehrlichia muris AS145 GATCAAGAGCAATATCAACATCAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 840944-841867	Sequence	EMUR_03415 glpX fructose 1,6-bisphosphatase (Protein is coded in complementary strand; from 841867 to 840944)