Sequence retrieval

Genome: Ehrlichia muris AS145
Start position: 833306
End position: 833332
Length: 27

DNA sequence
>NC_023063, from 833306 to 833332 (27 bp); Ehrlichia muris AS145 TCCTCCCATACCTCCCATGCCTCCCAT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 833301-834953	Sequence	EMUR_03390 - molecular chaperone GroeL (Protein is coded in complementary strand; from 834953 to 833301)