Sequence retrieval

Genome: Ehrlichia muris AS145
Start position: 453776
End position: 453817
Length: 42

DNA sequence
>NC_023063, from 453776 to 453817 (42 bp); Ehrlichia muris AS145 GTATAGTTCTCATCGTATAGTTCTCATCGTATAGTTCTCATC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF.. 453628-453789	Sequence	EMUR_01790 - hypothetical protein (Protein is coded in complementary strand; from 453789 to 453628)