Sequence retrieval

Genome: Ehrlichia muris AS145
Start position: 1065976
End position: 1066005
Length: 30

DNA sequence
>NC_023063, from 1065976 to 1066005 (30 bp); Ehrlichia muris AS145 ATGATGATGATGCTGATGATGATGATGCTG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1065975-1066340	Sequence	EMUR_04260 - type VI secretion protein (Protein is coded in complementary strand; from 1066340 to 1065975)