Sequence retrieval

Genome: Ehrlichia muris AS145
Start position: 104259
End position: 104288
Length: 30

DNA sequence
>NC_023063, from 104259 to 104288 (30 bp); Ehrlichia muris AS145 ATAAAATTGTAAAAAATTGCATAAAACTTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 102541-104490	Sequence	EMUR_00430 - hypothetical protein (Protein is coded in complementary strand; from 104490 to 102541)