Sequence retrieval

Genome: Francisella noatunensis subsp. orientalis LADL--07-285A
Start position: 805396
End position: 805419
Length: 24

DNA sequence
>NC_023029, from 805396 to 805419 (24 bp); Francisella noatunensis subsp. orientalis LADL--07-285A TTTTTCTATTTTTATATTTTGCTA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 805374-806003	Sequence	M973_04415 - 4Fe-4S ferredoxin (Protein is coded in complementary strand; from 806003 to 805374)