Sequence retrieval

Genome: Francisella noatunensis subsp. orientalis LADL--07-285A
Start position: 189408
End position: 189437
Length: 30

DNA sequence
>NC_023029, from 189408 to 189437 (30 bp); Francisella noatunensis subsp. orientalis LADL--07-285A TTTTTTCCATTTTGTTCCTTTTTTATCTAT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF.. 188882-189418	Sequence	M973_01080 - membrane protein (Protein is coded in complementary strand; from 189418 to 188882)