Sequence retrieval

Genome: Francisella noatunensis subsp. orientalis LADL--07-285A
Start position: 1687664
End position: 1687708
Length: 45

DNA sequence
>NC_023029, from 1687664 to 1687708 (45 bp); Francisella noatunensis subsp. orientalis LADL--07-285A TCAGCAGCTTCAGCAGCAGCAGCTGGAGCAGCAGCAGCAACAGCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1687448-1687822	Sequence	M973_09220 - 50S ribosomal protein L7/L12 (Protein is coded in complementary strand; from 1687822 to 1687448)