Sequence retrieval

Genome: Francisella noatunensis subsp. orientalis LADL--07-285A
Start position: 1600258
End position: 1600287
Length: 30

DNA sequence
>NC_023029, from 1600258 to 1600287 (30 bp); Francisella noatunensis subsp. orientalis LADL--07-285A AGGAAAAACAATGCAAAACAATGAAAATCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF... 1600269-1600718	Sequence	M973_08780 - preprotein translocase subunit SecB