Sequence retrieval

Genome: Francisella noatunensis subsp. orientalis LADL--07-285A
Start position: 1437431
End position: 1437455
Length: 25

DNA sequence
>NC_023029, from 1437431 to 1437455 (25 bp); Francisella noatunensis subsp. orientalis LADL--07-285A AAAAAAGAAAAACAAAAAAGAAAAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1436500-1437813	Sequence	M973_07905 - hypothetical protein (Protein is coded in complementary strand; from 1437813 to 1436500)