Sequence retrieval

Genome: Candidate division WWE3 bacterium RAAC2_WWE3_1
Start position: 652100
End position: 652150
Length: 51

DNA sequence
>NC_023001, from 652100 to 652150 (51 bp); Candidate division WWE3 bacterium RAAC2_WWE3_1 CGCTATATTTCATATACTCCTATATTTCATATACTCCTATATTTCCTATAC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF.. 651298-652113	Sequence	P147_WWE3C00001G0664 - Glycosyl transferase family 2 (Protein is coded in complementary strand; from 652113 to 651298)